Cell Culture Growth Factors and Hormones
ABclonal Technology TGF beta induced TGFBI
This gene encodes an RGD-containing protein that binds to type I II and IV collagens The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion Mutations in this gene are associated with multiple types of corneal dystrophy
Medchemexpress LLC CD68 Rat HEK293 H 5ug
CD68 is a protein belonging to the LAMP (lysosome-associated membrane protein) family It is expressed primarily in macrophages monocytes and dendritic cells serving as a marker for these immune cells CD68 Protein Rat (HEK293 His) is the recombinant rat-derived CD68 protein expressed by HEK293 with C-His labeled tag
Medchemexpress LLC FGF-8e Human N-His 2ug
FGF-8e Protein Human is an isoform of FGF-8 an essential factor during embryonic development involved in the progression of prostate cancer
Medchemexpress LLC FGF-17 Mouse His 10ug
The FGF-17 Protein is crucial in regulating embryonic development functioning as a signaling molecule for inducing and patterning the embryonic brain It plays an essential role in normal brain development and interacts specifically with FGFR3 and FGFR4 receptors pivotal in this developmental process FGF-17 Protein Mouse (His) is the recombinant mouse-derived FGF-17 expressed by E coli with C-6 His labeled tag The total length of FGF-17 Protein Mouse (His) is 194 a a
Medchemexpress LLC Tau ASO-12 (murine) (sodium) | 00-00-0 | 97.2% | 7619.00 Da | 5 MG
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide intended for preclinical murine research. Supplied as the sodium salt in mg quantities, it is designed for studies of Tau biology and Alzheimer's disease models.
- Tau-lowering antisense oligonucleotide for murine models.
- Sequence: 5′ GCTTTTACTGACCATGCGAG 3′.
- Formulation: sodium salt.
- Molecular weight: 7619.00 Da.
- Purity: 97.2%.
- Storage: 4°C sealed; in solvent -80°C for 6 months, -20°C for 1 month.
- Available sizes: 1 mg, 5 mg, 10 mg, 50 mg (quote for 50 mg).
Medchemexpress LLC LIFR protein, rat (HEK293, His) | >95.0% | 50 UG
LIFR protein, rat is a recombinant, glycosylated form of the leukemia inhibitory factor receptor expressed in HEK293 mammalian cells and supplied as a lyophilized His-tagged protein for research use. It is designed for biochemical and cell-based assays, receptor binding and signaling studies, and antibody validation, with high purity and low endotoxin to support sensitive experiments.
- Expressed in HEK293 mammalian cells, preserving native post-translational modifications
- Contains a C-terminal His tag for detection and purification
- Glycosylated protein with an approximate molecular weight of 116 kDa
- Lyophilized formulation for convenient storage and transport
- Purity greater than 95% by reducing SDS-PAGE
- Endotoxin level <1 EU/μg suitable for cell-based work
- Recommended storage at -20°C; aliquot to avoid freeze-thaw cycles
Medchemexpress LLC Fms-like tyrosine kinase 3 (FLT3) protein, human, recombinant | >95.0% | 5 UG
Recombinant human FMS-like tyrosine kinase 3 (FLT3) extracellular domain fused to a human Fc tag, produced in HEK293 cells. Supplied lyophilized for convenient storage and reconstitution, the protein is intended for binding studies, antibody development, and biochemical assays targeting FLT3 signaling.
- Recombinant FLT3 extracellular domain with C-terminal human Fc tag.
- Expressed in HEK293 cells for mammalian glycosylation.
- Amino acid range N27-S543 (extracellular region).
- Molecular weight approximately 100-145 kDa.
- Purity greater than 95% by reducing SDS-PAGE.
- Lyophilized formulation; store frozen and aliquot after reconstitution.
American Research Products Inc Monkey Vascular Endothelial ce
Monkey Vascular Endothelial cell Growth Factor (VEGF) ELISA Kit from CUSABIO Detection Range 125 pg/mL-8000 pg/mL Sensitivity 31 25 pg/mL Sample serum plasma cell culture supernates cell lysates Method Sandwich
Sigma Aldrich Fine Chemicals Biosciences Zeatin suitable for plant cell culture, BioReagent, powder | 13114-27-7 | MFCD00213654 | 250MG
Zeatin suitable for plant cell culture, BioReagent, powder | Mol Wt: 219.24 | 13114-27-7 | MFCD00213654 | 250MG
American Research Products Inc Rabbit Transforming Growth fac
Rabbit Transforming Growth factor b1 TGF-b1 ELISA Kit from CUSABIO Detection Range 3 125 ng/ml-50 ng/ml Sensitivity 0 625ng/ml Sample serum plasma tissue homogenates Method Sandwich
American Research Products Inc Chicken growth hormone GH ELI
Chicken growth hormone GH ELISA KIT from CUSABIO Detection Range 625 pg/mL-10000 pg/mL Sensitivity 625 pg/mL Sample serum plasma tissue homogenates Method Competitive
American Research Products Inc Mouse FGF21 ELISA Kit
This Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit is a precoated Sandwich ELISA assay designed to detect and quantify the target analyte in serum plasma tissue homogenates cell lysates cell culture supernatants and other biological fluids This product is for Research Use Only
Medchemexpress LLC IL-12 Mouse HEK293 100ug
Recombinant mouse interleukin-12 (IL-12) produced in HEK293 mammalian cells and supplied tag-free for research use. The heterodimeric cytokine is provided lyophilized with defined buffer formulations and high purity, suitable for cell activation assays, cytokine signaling studies, and other immunology research applications.
- Produced in HEK293 mammalian expression system.
- Tag-free heterodimeric cytokine.
- Available in multiple sizes, including 100 μg.
- Purity greater than 95% as determined by reducing SDS-PAGE.
- Lyophilized formulation for stability and ease of storage.
- Recommended aliquoting and storage at -20°C or -80°C for extended preservation.
Medchemexpress LLC PDGF-CC Mouse HEK2 10ug
The PDGF-CC protein is a key growth factor that plays crucial roles in a variety of cellular processes including embryonic development cell proliferation migration survival and chemotaxis It has potent mitogenic and chemoattractant properties and is essential during embryonic skeletal formation craniofacial development palate development skin morphogenesis and wound healing stages PDGF-CC Protein Mouse (HEK293 Fc) is the recombinant mouse-derived PDGF-CC protein expressed by HEK293 with N-hFc labeled tag
Medchemexpress LLC Acetoxymethyl 2-(5-phenyl-1H-indol-3-yl)acetate | 2990123-10-7 | 99.0% | C19H17NO4 | 10MG
5-Ph-IAA-AM is an eggshell-permeable acetoxymethyl derivative of 5-Ph-IAA designed for use in auxin-inducible degron (AID2) systems. It provides enhanced protein degradation in laid C. elegans embryos, enabling temporally controlled depletion of target proteins to study embryogenesis and developmental processes.
- Eggshell-permeant analog facilitates delivery into laid embryos.
- Enhances protein degradation efficiency in AID2 systems.
- Compatible with OsTIR1(F74G)-mediated auxin-inducible degron assays.
- High purity supports reproducible experimental results.
- Powder is stable under recommended cold storage conditions.